rs10882967 chr10:97574051 C>T
- Sequence
cccagcattttgagatctgagatc[C/T]gaggtgggcagatcacttgaagtc
- ASB in cell types
- RMG-1
- ASB for transcription factors
- ARI1A_HUMAN CNDH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1A_HUMAN | -1.82 | 2.33 | 1.00 | n/a | n/a | |||
| CNDH2_HUMAN | -1.85 | 2.11 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood