rs10883373 chr10:99532727 G>A
- Sequence
atcaatggttcaggaaccggatct[G/A]tgcagcctcgcccgcagcgtctcg
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-SY-2(Monophasic synovial sarcoma) | 1.59 | -0.53 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Nucleus_accumbens_basal_ganglia, Colon_Sigmoid, Colon_Transverse, Minor_Salivary_Gland, Small_Intestine_Terminal_Ileum, Spleen, Thyroid