rs10883858 chr10:103367951 G>A
- Sequence
ccccgccctccatgtggcgaaaat[G/A]caatcacgcttgacggcgcgaggt
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line) MDA-MB-231 (breast adenocarcinoma) HCT-116 (colon carcinoma)
- ASB for transcription factors
- BRD2_HUMAN CTCF_HUMAN KMT2A_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD2_HUMAN | 1.16 | 0.09 | 1.97 | n/a | n/a | |||
| CTCF_HUMAN | 0.90 | 0.38 | 1.15 | n/a | No Hit | |||
| KMT2A_HUMAN | 1.86 | -0.38 | 1.33 | n/a | n/a | |||
| JUN_HUMAN | 1.37 | 0.43 | 2.00 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, college completion, estimated total intracranial volume (excluding patients with neuropsychiatric disorders), prop taste detection threshold
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood