rs10887884 chr10:80444908 C>T
- Sequence
catcaactgctgcgcagctctccc[C/T]ggggactaccagattctccatgga
- ASB in cell types
- ID00015 (lymphoblastoid cell) GM19238 (female B-cells lymphoblastoid cell lines) transverse colon CUTLL1 (T-cell lymphoblastic lymphoma 1)
- ASB for transcription factors
- RAD21_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.10 | 0.36 | 1.46 | n/a | n/a | |||
| CREB1_HUMAN | 2.21 | -1.89 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP birth weight, ldl cholesterol, obesity with early age of onset (age >2), rheumatoid arthritis, serum creatinine
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Liver, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood