rs10889767 chr1:40968181 A>G
- Sequence
tgtaatcccagcactttgggagac[A/G]gaggcagaggcatgcggatcacaa
- ASB in cell types
- RMG-1
- ASB for transcription factors
- ARI1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1A_HUMAN | -1.13 | 1.73 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Heart_Atrial_Appendage, Liver, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood