rs10891105 chr11:110435605 T>C
- Sequence
ctcaggcctgtaatctcagagttt[T/C]aggaggccaagttgagaagatggc
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) foreskin keratinocyte GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -3.35 | 3.51 | 1.00 | |||
| foreskin keratinocyte | 2.25 | -3.82 | 2.33 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -2.13 | 2.27 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Stomach, Thyroid, Whole_Blood