rs10893900 chr11:128632327 A>G
- Sequence
tacagagaccccttctgcccaaat[A/G]ctggtggtgcaatgcagccaaccg
- ASB in cell types
- WA09 (embryonic stem cells) SUM159PT (Triple negative breast cancer) adrenal gland T47D (invasive ductal carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.80 | 1.04 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, college completion, rheumatoid arthritis, total cholesterol, total cholesterol change with statins, triglycerides change with statins, years of education