rs10898438 chr11:86147211 G>A
- Sequence
gggaagtgtgaggccatgggtgtg[G/A]gtgtcggttacagcagagagcgtt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.87 | 0.03 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. controls), immediate story recall, parkinsons disease, primary rhegmatogenous retinal detachment, rheumatoid arthritis, spine bone mineral density (bmd), waist hip ratio
GTEx eQTL Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg