rs10901606 chr10:126387313 C>T
- Sequence
taaggggctacaactcgggaaaac[C/T]taagtctgtaaaactaagtacgtt
- ASB in cell types
- upper lobe of left lung GM18526 (B – cells Lymphoblastoid Cell Lines) Peyer's patch GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| upper lobe of left lung | 2.30 | -1.98 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -1.81 | 2.20 | 1.00 | |||
| Peyer's patch | -2.22 | 2.19 | 1.00 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -0.93 | 1.59 | 1.00 |
Items per page:
1 – 4 of 4