rs10904906 chr10:17203213 A>C
- Sequence
gaatccgcttggtggaggtgttca[A/C]tcagtcagttggggggagcttaga
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.12 | 0.53 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), bipolar disorder and schizophrenia, college completion, cystatin c in serum, ldl cholesterol, neuroticism, parkinsons disease, total cholesterol, years of education
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Muscularis, Whole_Blood