rs10915140 chr1:30512804 T>C
- Sequence
accccagggccctccggagtccca[T/C]ggctggaagcatctctcatctaga
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 1.22 | -0.63 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, ldl cholesterol change with statins, prop taste detection threshold, total cholesterol change with statins, type 2 diabetes, type 2 diabetes (females), type 2 diabetes (males), type 2 diabetes family history