rs10920476 chr1:190084748 T>C
- Sequence
cttttggcaggaagcagttaagat[T/C]agtcttcgtccttatccttattct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia) glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -0.41 | 1.11 | 1.00 | |||
| K562 (myelogenous leukemia) | -0.49 | 1.10 | 3.00 | |||
| glioblastoma cells | 1.63 | -2.90 | 1.50 |
Items per page:
1 – 3 of 3