rs10946155 chr6:166310824 T>C
- Sequence
tctgtcgctggccctcactggtgc[T/C]gtggctgttaaagaatccgttaca
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.07 | 0.99 | 1.05 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, hypertension (early onset hypertension), ldl cholesterol, plasma aldosterone concentration, plasma aldosterone concentration corrected by plasma renin activity, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp)