rs10947479 chr6:34163599 A>G
- Sequence
ccagtgagaggctgaaggtgaccc[A/G]ctttgtaaccatgaagaactctcc
- ASB in cell types
- SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | n/a | 2.49 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), ldl cholesterol, primary rhegmatogenous retinal detachment, prop taste detection threshold, refractive error, total cholesterol