rs10950648 chr7:17167132 T>C
- Sequence
tactggaggagagagtattctttc[T/C]cggttctgctatggctgtctcacc
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM12878 (female B-cells lymphoblastoid cell line) GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN RAD51_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.74 | -3.95 | 1.11 | n/a | No Hit | |||
| RAD51_HUMAN | 2.30 | -1.98 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, paternal transmission distortion, rheumatoid arthritis, transmission distortion