rs10951446 chr7:4152179 A>C
- Sequence
ccgccacggaactggcagccaaga[A/C]ataaggcaatcggaagagtcagac
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.07 | 0.69 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, barnes akathisia rating scale, refractive error, transmission distortion, urinary albumin-to-creatinine ratio