rs10951900 chr7:47266572 G>A
- Sequence
caggggaaatggctcactggggac[G/A]tgtgtgcacagaagtcctctccgt
- ASB in cell types
- coronary artery foreskin keratinocyte HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| coronary artery | -2.15 | 2.42 | 1.00 | |||
| foreskin keratinocyte | n/a | 0.79 | 2.50 | |||
| HCT-116 (colon carcinoma) | 0.88 | 0.48 | 1.00 |
Items per page:
1 – 3 of 3