rs10955093 chr8:86893023 C>G
- Sequence
tacacataaaagaaatgatctgag[C/G]ttcgagccattaaacattgctttg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) PC9 (lung adenocarcinoma) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.06 | 1.11 | 1.38 | |||
| PC9 (lung adenocarcinoma) | 1.46 | -0.45 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 1.10 | -0.30 | 2.00 |
Items per page:
1 – 3 of 3