rs10961548 chr9:1460427 A>C
- Sequence
tggacgagtgagggtttgaggcag[A/C]aaggagtgaggcgtggatgtattt
- ASB in cell types
- pancreas ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | 0.20 | 2.31 | 1.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | -1.29 | 1.29 | 1.00 |
Items per page:
1 – 2 of 2