rs10991417 chr9:104926348 A>C
- Sequence
atttctttgcttctttttgataaa[A/C]gatatacctaaagaggcacctaca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 2.23 | 0.48 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic