rs10998021 chr10:68208432 G>A
- Sequence
ggacttgagaagagattaaactgt[G/A]aaggaagcagacactaatgtactt
- ASB in cell types
- RWPE1 (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RWPE1 (prostate epithelial cells) | 2.11 | -1.76 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, aortic valve calcium, birth weight, hdl cholesterol, neuroticism, nicotine dependence (smoking), smoking cessation (nicotine replacement therapy) , nicotine dependence (smoking), smoking cessation (with bupropion hydrochloride), triglycerides, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Muscle_Skeletal, Testis, Thyroid