rs10999773 chr10:71323710 A>G
- Sequence
tgggaggttctgttatggaagaca[A/G]ggaaaatgaatccgaagggataat
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ZN143_HUMAN CSN2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN143_HUMAN | 1.34 | -1.34 | 1.00 | n/a | No Hit | |||
| CSN2_HUMAN | 2.74 | n/a | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, barnes akathisia rating scale, lp-pla2 activity, partial epilepsy, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg