rs11000123 chr10:71978651 T>C
- Sequence
ctcacagcgctcccatgtggtagg[T/C]gctgtccttatactctttttgcag
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.07 | 1.97 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Heart_Left_Ventricle, Minor_Salivary_Gland, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid