rs11021441 chr11:96122855 C>G
- Sequence
agaggaaatacaagctgcaagccc[C/G]tgcattatgcatagtgaatatcct
- ASB in cell types
- MCF10A (breast epithelial cells)
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | 0.28 | 1.55 | 1.50 | -1.31 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
