rs11023715 chr11:15765116 C>G
- Sequence
acctgttagacatgcaaattattg[C/G]accacaactctgacttaactgagc
- ASB in cell types
- ESO-26 (Gastroesophageal junction adenocarcinoma)
- ASB for transcription factors
- KLF5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KLF5_HUMAN | 2.67 | -2.34 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, ldl cholesterol, lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), total cholesterol