rs11023756 chr11:15875869 C>T
- Sequence
ggaccagctatggtttgaacattc[C/T]tatcttaatggtattctaaaagct
- ASB in cell types
- iPS-derived chondrocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| iPS-derived chondrocytes | 1.04 | -0.68 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), fasting blood glucose, homa-ir, ldl cholesterol, serum creatinine, total cholesterol