rs11040976 chr11:6711606 A>G
- Sequence
gtaattattctttattccaatatt[A/G]taataatccttgctctacaatcat
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 1.51 | -1.54 | 1.00 | |||
| foreskin keratinocyte | 1.29 | -0.26 | 1.83 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Nerve_Tibial, Thyroid, Whole_Blood