rs11041476 chr11:1853837 G>A
- Sequence
gagggggcatggcagaggttgtgt[G/A]taggactgccagagctgggcagaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.85 | 0.84 | 1.04 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), infant head circumference, ldl cholesterol change with statins, total cholesterol change with statins
GTEx eQTL Adrenal_Gland, Artery_Tibial, Brain_Hypothalamus, Brain_Spinal_cord_cervical_c-1, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid