rs11052135 chr12:32657787 G>A
- Sequence
tctaagggtttcaaactatgataa[G/A]tgactaaccacattctgtgctctg
- ASB in cell types
- foreskin keratinocyte HeLa S3 (cervical adenocarcinoma) smooth muscle cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.79 | n/a | 2.17 | |||
| HeLa S3 (cervical adenocarcinoma) | 1.35 | 0.13 | 1.80 | |||
| smooth muscle cell | 2.13 | -1.59 | 1.00 |
Items per page:
1 – 3 of 3