rs11056280 chr12:14996107 T>C
- Sequence
aaattgacaagcagaaattgtaca[T/C]atttttggtgtacaatgtgatgtt
- ASB in cell types
- Peyer's patch IPSC-derived bipolar neuron bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | -0.08 | 1.35 | 1.00 | |||
| IPSC-derived bipolar neuron | 1.95 | -0.77 | 1.00 | |||
| bipolar neuron | 1.12 | -0.73 | 1.25 |
Items per page:
1 – 3 of 3