rs11065494 chr12:121223811 A>C
- Sequence
gaagaatctcttgaacctgggagg[A/C]ggaggttgctgagctgagatggtg
- ASB in cell types
- T47D (invasive ductal carcinoma) MCF10A (breast epithelial cells) epithelial cell of prostate GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.26 | 0.01 | 1.45 | |||
| MCF10A (breast epithelial cells) | 1.60 | -0.48 | 1.06 | |||
| epithelial cell of prostate | 1.68 | -1.44 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 0.70 | -0.43 | 1.00 |
Items per page:
1 – 4 of 4