rs1107004 chr2:156341400 G>C
- Sequence
ttagcgccattaacttgagactta[G/C]agtctatctaccaggacggatgga
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- HNRLL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNRLL_HUMAN | 2.47 | n/a | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), fasting blood glucose, triglycerides