rs11070477 chr15:45903516 C>G
- Sequence
tcaatagctacttcctccctccct[C/G]ccttcctccctttcttcttgcctc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- ERG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ERG_HUMAN | -2.99 | 3.05 | 1.00 | -2.23 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
