rs11071525 chr15:60397039 C>G
- Sequence
gaataggcatccttaagccacctt[C/G]ccagatgaggaaacttatctgtgt
- ASB in cell types
- K562 (myelogenous leukemia) A549 (lung carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.76 | 0.15 | 2.00 | |||
| A549 (lung carcinoma) | 0.80 | 0.58 | 1.10 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.34 | 0.74 | 1.07 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Whole_Blood