rs11072817 chr15:78944473 G>A
- Sequence
cagatgggactcccaagacactac[G/A]gggatcccctgtgtgccaagtccc
- ASB in cell types
- T47D (invasive ductal carcinoma) bipolar neuron GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- PRGR_HUMAN EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRGR_HUMAN | -0.00 | 2.00 | 2.20 | n/a | No Hit | |||
| EZH2_HUMAN | 2.25 | -1.83 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, coronary artery disease (cad), cystatin c in serum, hdl cholesterol, systolic blood pressure (sbp), total cholesterol, triglycerides
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Pancreas, Spleen, Testis, Thyroid, Whole_Blood