rs11085102 chr19:4812991 A>G
- Sequence
tgtctgctgtctgggacaactccc[A/G]gcacacagtaggcgctggatgaac
- ASB in cell types
- K562 (myelogenous leukemia) HAEC (human aortic endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.68 | 0.17 | 2.00 | |||
| HAEC (human aortic endothelial cells) | 2.66 | -0.12 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood