rs11086148 chr20:62972795 A>C
- Sequence
ggggcctgatggcctgatggacgg[A/C]gggcaagaacccttccaccatccg
- ASB for transcription factors
- COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | 2.71 | -2.78 | 1.00 | -5.47 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
