rs1109362 chr8:96495262 G>A
- Sequence
ggggccgggaggagtctcgtctcc[G/A]gcggagcgcctgccggcacccagc
- ASB in cell types
- breast tumor upper lobe of left lung 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ZBT26_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZBT26_HUMAN | 1.38 | -1.38 | 1.00 | n/a | n/a | |||
| ESR1_HUMAN | 2.46 | -1.50 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, fasting blood glucose, homa-ir, obesity with early age of onset (age >2), years of education