rs11105913 chr12:91009599 C>T
- Sequence
tcacctgcttccatgctataatta[C/T]aacaaaaacaataatatgttaaca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.42 | 0.90 | 1.08 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 2.06 | n/a | 1.00 |
Items per page:
1 – 2 of 2