rs11118530 chr1:220335700 T>G
- Sequence
ttataaccaatactgaaagccacg[T/G]tcctgttgccaatatgcctggaag
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ZR-75-1 (invasive ductal carcinoma) | 1.70 | 0.02 | 4.43 |
Items per page:
1 – 1 of 1