rs111217331 chr10:70960879 G>A
- Sequence
gtgtatgtgagtgtgagtgtgtgc[G/A]tgtatgtgtgtgtgagaatgagta
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.67 | 0.67 | 1.03 | |||
| HEK293 (embryonic kidney) | n/a | 2.73 | 3.00 |
Items per page:
1 – 2 of 2