rs11124031 chr2:105404484 G>A
- Sequence
gtggtggcacagaaagctggattc[G/A]ctttttctggaaacactatttgcc
- ASB in cell types
- keratinocytes HS-ES-2M (Epithelioid sarcoma)
- ASB for transcription factors
- SNAI2_HUMAN P63_HUMAN SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | 4.17 | -4.16 | 1.00 | n/a | No Hit | |||
| P63_HUMAN | 0.99 | 0.41 | 1.03 | n/a | No Hit | |||
| SMRC1_HUMAN | 2.40 | 0.65 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, obesity with early age of onset (age >2), total cholesterol