rs111352201 chr2:41918921 G>C
- Sequence
cccccaagagcacacgccagtgtg[G/C]caaactcattagaggcaaggattt
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -1.85 | 2.49 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1