rs11175398 chr12:64457198 G>A
- Sequence
tctgtcagtgacgatgagataagc[G/A]tacatgggggaggggctgtttcct
- ASB in cell types
- K562 (myelogenous leukemia) CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- MEIS2_HUMAN PKNX1_HUMAN NCOR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEIS2_HUMAN | n/a | 1.53 | 2.00 | n/a | No Hit | |||
| PKNX1_HUMAN | n/a | 1.42 | 2.00 | n/a | No Hit | |||
| NCOR1_HUMAN | -0.94 | 1.71 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, aortic valve calcium, asthma, chronic kidney disease, obesity with early age of onset (age >2), recurrent major depressive disorder, serum creatinine, tetrology of fallot, total cholesterol, transmission distortion, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Spleen, Testis