rs11177731 chr12:69585297 C>T
- Sequence
ttctatggcaacccgcgcggcagc[C/T]gcctctttgttctggagcggcggc
- ASB in cell types
- Th1-cells 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN TBX21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.73 | -0.58 | 2.00 | n/a | No Hit | |||
| TBX21_HUMAN | -1.19 | 2.20 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood