rs11184298 chr1:103515168 C>A
- Sequence
cagaatatgaaaataggcccagtg[C/A]actcaaacatacatgcatgcatga
- ASB in cell types
- PC9 (lung adenocarcinoma) coronary artery
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | 1.06 | -2.62 | 1.50 | |||
| coronary artery | -1.36 | 1.64 | 1.00 |
Items per page:
1 – 2 of 2