rs11203209 chr21:42715342 T>C
- Sequence
tcctgcatcagattgtatattggt[T/C]acagccgggcgcactggctcacgc
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.28 | -0.90 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1