rs11221328 chr11:128492438 A>G
- Sequence
agagtccaggctgtgccctggaag[A/G]acagaagggctccctagctgctct
- ASB in cell types
- MDM(monocyte derived macrophages) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.32 | n/a | 3.00 | |||
| 22RV1 (prostate carcinoma) | 2.64 | 0.74 | 2.00 |
Items per page:
1 – 2 of 2