rs11237351 chr11:78000329 A>G
- Sequence
atgggtgccctctggtggacattc[A/G]caaggagcacagacatttacacct
- ASB in cell types
- KMS-11 (Plasma cell myeloma) K562 (myelogenous leukemia) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 (Plasma cell myeloma) | n/a | 1.57 | 2.33 | |||
| K562 (myelogenous leukemia) | 0.77 | 0.00 | 1.98 | |||
| CD34+ stem cells-derived erythroblasts | 2.33 | -2.42 | 2.00 |
Items per page:
1 – 3 of 3