rs112382193 chr17:48620360 C>A
- Sequence
tgcgatcttcataagaggctctgg[C/A]gaaatccctcagtctgagagggac
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-SY-2(Monophasic synovial sarcoma) | 0.93 | 0.34 | 1.67 | |||
| K562 (myelogenous leukemia) | 0.80 | -0.06 | 2.00 |
Items per page:
1 – 2 of 2